-

<<


Pages:     || 2 | 3 | 4 | 5 |   ...   | 52 |

I 70- 1518 ...

-- [ 1 ] --

70-

1518 2013 .,

I

70-

1518 2013 .,

I

2013 082 94.3 23 :

..;

- , ..;

, ..;

- , ..;

, ..;

, ..;

..;

, ..;

, ..;

, ..;

, ..;

, ..;

- , ..;

- , ..;

, ..;

, ..;

- ..;

..;

- , ..;

- , ..;

..;

- , ..;

- , ..;

- ..;

, ..;

, ..;

..;

, ..;

, ..;

- , ..;

, ..;

- , ..;

, ..;

- , ..;

, ..;

- , ..;

- , ..;

, .. .

70- , 1518 2013 ., : 3 .

. 1 / . . -. : . ;

2013.

, , , , , , , 94. ;

CRN1 CRN

PHYTOPHTHORA INFESTANS

. . , . .

Phytophthora infestans , , . P. infestans , , , [13].

, . P. infestans [46]. P. infestans, .. , -, crn1 crn2. , CRN- in planta [7].

crn1 crn2 P. infestans, 2010 .

P. infestans: -2, -3, 2BH13, 1B21, 2, -6, Bu-1, -4, -3 ( ) -5m ( ). P. infestans ryeA 18.

P. infestans 250 100 , .

, [8].

(, ):

crn1F (TTGAAGCTATTGCGCGTTGCAGG) crn1R (GCTGCAGCTCACAAGTTGACCAAT) crn2F (AAATTCACGTGCTGGTGGTTC) crn2R (CAAATGCTTCACCTGGCGCGATTA) 94 150 , 30 94 40 , 58 60 , 72 60 , 1 72 60 .

P. infestans 1520 . , P. infestans, crn1 crn2. - 12.

. 1. P. infestans #SMO331 (Fermentas, );

P. infestans crn1 1-5;

crn2 6-10;

1, 6 -2;

2, 7 -3;

3, 8 -5m;

4, 9 2BH13;

5,10 1B . 2. P. infestans crn1 crn2:

#SMO331 (Fermentas, );

P. infestans crn1 1-5;

crn2 6-10;

1, 6 Bu-1;

2, 7 2;

3, 8 -3;

4, 9 -4;

, P. Infestans , .. 700 . ., : crn1 681.. ( 1, 2: 15) crn2 710 .. ( 1, 2: 610).

crn1 crn2. , Bsu15I (Cla ), Pvu, Sca crn1 Dra, EcoR crn2. 38.

. 3. :

crn1 1-5, crn2 6-10;

Bsu15I ( 1-5);

EcoR ( 6-10);

: 1, 6 -2;

2,7 -3;

#SMO331 (Fermentas, ) . 4. 1 -2;

2 -2;

3 Bu-1;

4 2;

5 -3;

6 -6;

#SMO331 (Fermentas, ) crn1 Bsu15I crn2 EcoRI 500 300 .., : Bsu151 448 233 .., EcoR 461 249 .. (. 3, 4).

- P. infestans crn1 crn2 58.

. 5. :

crn1 15, crn2 6-10;

15 Pvu;

610 Dra;

1, 6 -2;

2, 7 -3;

3, 8 -5m;

4, 9 2BH13;

5, 10 1B21;

#SMO331 (Fermentas, ) .6. 1 -2;

2 -2;

3 Bu-1;

4 2;

5 -3;

6 -6;

#SMO331 (Fermentas, ) (. 5, 6) 500 200 .., ( Pvu 542 139 .., Dra 528 182 ..).

. 7. :

crn1 Sca: 1 -2;

2 -3;

3 -5m;

4 2BH13;

5 1B21;

#SMO331 (Fermentas, ) 7 crn1 ScaI, 500 300 .. ( 419 262 ..).

, 8, crn1 crn2 P. infestans 500 300 .., .

, P. infestans , crn1 crn2. crn1 crn2, .

P. Infestans CRN1 CRN2 , .

. 8. :

crn1 1-10;

crn2 11-15;

Sca 6-10;

EcoR 11-15;

Bu-1 1, 6, 11;

2 2, 7, 12;

-3 3, 8, 13;

-4 4, 9, 14;

-6 5, 10, 15;

#SMO331 (Fermentas, ) ... .. P. infestans ... ..

crn1 crn2 P. infestans.

1. . . . .: , 2002.

2. . .

, . ., 2005.

3. Haas . J. Genome sequence and analysis of the Irish potato famine pathogen Phytophthora infestans / S. Kamoun, M. C. Zody, R. H. Y. Jiang, R. E. Handsaker et. al. // Nature. 2009. V. 461. P. 393398.

4. Kamoun S. Catalogue of the Effector Secretome of Plant Pathogenic Oomycetes / S.Kamoun // Annu. Rev. Phytopathol. 2006. V. 44. P. 4160.

5. Kamoun S. Molecular genetics of pathogenic oomycetes / S.Kamoun // Eukaryotic Cell. 2003. V. 2. P. 191199.

6. Thines M. Oomycete Plant coevolution: recent advances and future prospects /M.

Thines, S.Kamoun// Curr. Opin. Plant Biol. 2010. V.13. P. 17.

7. Torto . EST mining and functional expression assays identify extracellular effector proteins from Phytophthora / S. Li, A. Styer, E. Huitema, A. Testa et al. //Genome Res.

2003. V.13. P. 7585.

8. Moller E. M. A simple and efficient protocol for isolation of high molecular weight DNA from filamentous fungi, fruit bodies and infected plant tissues / G. Bahnweg, H. Sandermann, H. H. Geiger // Nucleic Acids Res. 1992. V. 20, 22. P. 61156116.

-

POLYPODIUM VULGARE L. ALLIUM URSINUM L.

. . , .

, - , , . - , . , ,

.

- . - , .

(Pulsatilla pratensis s.l., Cotoneaster melanocarpus s.l., Prunus spinosa s.l., Trapa natans s.l., Gentianella amarella s.l., Allium ursinum s.l., Gymnadenia conopsea s.l. .) , . , , , .

Allium ursinum L. . , - . - , , ( , 2005). : Allium ursinum subsp.



Pages:     || 2 | 3 | 4 | 5 |   ...   | 52 |
 







 
<<     |    
2013 www.kon.libed.ru - -